However, we have shown that reintroduction of the purified arginine-methylated baculovirus produced MRN complex into PRMT1 siRNA-treated cells significantly rescued the phenotype. NSC 146109 hydrochloride (panel). ( 0.01). (panels) or PRMT1-/- ES cells (panels) 16 h following either mock treatment (panels) or DNA damage induced with a low dose of 500 nM etoposide (panels). The percentage of cells in the G0/G1, S, or G2/M phases of the cell cycle is indicated. In this study, we provide evidence that MRE11 is arginine methylated by NSC 146109 hydrochloride PRMT1. First, we showed that the aDMA-specific ASYM25 antibody and Arg587 MRE11 site-specific antibody directly recognized MRE11 by immunoblotting. It was also shown that MRE11 incorporated [3H]-methyl groups in a known in vivo methylation assay, and this incorporation was absent in PRMT1-/- cells. It was also shown that the MRE11 GAR domain was methylated by PRMT1 in vitro. Lastly, we identified by MALDI-TOF that peaks that corresponded to the mass of methylated MRE11 peptides and most of the peptide peaks were less abundant or totally absent in the MTA-treated cells (data not shown). The identification by mass spectrometry of multiple methylated peptides corresponding to MRE11 and the low abundance of unmethylated peptides within the GAR domain suggest that MRE11 exists predominantly in the methylated form. By using the methyl-specific antibodies Arg587 and ASYM25, we observed no difference in MRE11 methylation or global methylation following genotoxic treatments (data not shown). Similarly, the methylation of MAFF histone H3 Lys 79, involved in the recruitment of 53BP1 to sites of DNA damage, is not regulated with DNA damage (Huyen et al. 2004). Cells harboring mutations in ATM, MRE11, or NBS1 (Savitsky et al. 1995; Carney et al. 1998; Varon et al. 1998; Stewart et al. 1999) or cells down-regulated in the protein MDC1 (Goldberg et al. 2003; Lou et al. 2003; Stewart et al. 2003) display intra-S-phase checkpoint defects. Our study suggests a role for arginine methylation and PRMT1 in this process. Cells pretreated with methyltransferase inhibitors displayed an intra-S-phase defect following DNA damage, demonstrating a requirement for methylation in this response. As methyltransferase inhibitors have a broad specificity, other type of methylation events cannot be ruled out solely based on this observation. The PRMT1 siRNA-treated cells displayed an intra-S-phase checkpoint defect similar to that of MTA-treated cells, narrowing down the observed phenotype to the inhibition of PRMT1 activity. Moreover, PRMT1-/- ES cells displayed a slower progression through S phase following DNA damage. Based on these experiments, it is likely that several methylated proteins contribute to this intra-S-phase checkpoint defect. However, we have shown that reintroduction of the purified arginine-methylated baculovirus produced MRN complex into PRMT1 siRNA-treated cells significantly rescued the phenotype. These findings demonstrate that the MRN complex can alleviate the intra-S-phase checkpoint defect observed in these cells. Collectively, our results suggest NSC 146109 hydrochloride that the arginine methylation may regulate the MRE11 exonuclease activity during the intra-S-phase checkpoint response. In summary, the results presented herein suggest that arginine methylation, a poorly characterized post-translational modification, plays a crucial role in regulating the DNA damage response. Materials and methods Antibodies The peptides used to generate rabbit antibodies against MRE11 and methylated 587 MRE11 were as follows: MRE11 (amino acids 597-621) NSC 146109 hydrochloride (kstrqqpsrnvttknysevievdes) and Arg587 (KGQNSASRGGSQRGR), where the arginine marked with an asterisk is aDMA. Antibodies against PRMT1 and Sam68, SYM10 were from Upstate Biotechnology, and anti-NBS1 and anti-RAD50 were from Novus Biologicals. DNA constructs The full-length human MRE11 was amplified by PCR from HeLa cells cDNA and cloned in pFAST-Bac1. The arginine-to-alanine MRE11 mutations were generated by ligating double-stranded oligonucleotides with the sequence 5-GGAGCAGGCGCAGGAGCAGGTGCAGCAGGTGGAGCAGGGCAAAATTCAGCATCGGCAGGAGGGTCTCAAGCAGGAGCA-3, and the arginine to lysine MRE11 mutation was generated by ligating 5-GGAAAAGGCAAAGGAAAAGGTAAGAAAGGTGGAAAAGGGCAAAATTCAGCATCGAAAGGAGGGTCTCAAAAAGGAAA G-3 into a SmaI site created by inverse PCR using the following oligonucleotides 5-TCCCCCGGGGTTGGTTGCTGCTGAGATGCTATC-3 and 5-TCCCCCGGGGACACTGGTCTGGAGACTTCTACC-3. Mass spectrometry Endogenous MRE11 was immunopurified from 5 108 HeLa cells by using 1 mg of our NSC 146109 hydrochloride rabbit anti-MRE11 antibody coupled to 1 1 g of protein A-Sepharose (Sigma-Aldrich). After extensive washings with lysis buffer and 1 phosphate-buffered saline (PBS), the bound proteins were eluted with 250 M of the MRE11 peptide in 1 PBS. Eluted proteins were resolved by SDS-PAGE and revealed by Coomassie blue staining. The apparent bands were excised, in-gel digested with trypsin, and analyzed by MALDI-TOF analysis on a Voyager DE-STR mass spectrometer (University of Calgary, Alberta). Methylation assays GST-MRE11 (554-680; from M. Bedford, University of Texas, Smithville, TX) was incubated with GST-PRMT1, GST-PRMT3, GST-PRMT4 or with immunoprecipitated PRMT5 with 0.55 Ci of [methyl-3H] AdoMet in the presence of 25 mM Tris-HCl at pH 7.5 for 1 h at 37C in a final volume of 30.